Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0317
Clone ID GC0317
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0317
Sequence
CTGTANTCGTAGCCGGGGCCGTAGCCGTAATAGCCATAGGGCGAGTAGTCATAGCCGCCATAGCCCGGCCCGTAGCCCTG
CTGGTAG
Sequence Type mRNA
Unitrap ID UNI58

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 51415251..51415337 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020358 (Hnrpab) NM_010448 heterogeneous nuclear ribonucleoprotein A/B Gene [Source:MGI (curated);Acc:Hnrpab-003]

 
Come back to gene ENSMUSG00000020358


For any suggestions or comments, please send an email to unitrap@crg.es