Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST404897
Clone ID OST404897
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST404897
Sequence
ACGGCAGAAGCTAAACCTGATGCTAAGAGCCCCAAGACTGGGGCAAGGCCCCAAGGTGGTGCTGACGCTGGAGAACCTAC
CACCCTCCTCCAAAGGCTCCGAGGTACCATTTCCAAGGCCGTGCAGAACAAAGTA
Sequence Type mRNA
Unitrap ID UNI19094

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 94758958..94759295 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005774 (Rfx5) NM_017395 regulatory factor X, 5 (influences HLA class II expression) Gene [Source:MGI (curated);Acc:Rfx5-004]

 
Come back to gene ENSMUSG00000005774


For any suggestions or comments, please send an email to unitrap@crg.es