Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST404756
Clone ID OST404756
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST404756
Sequence
ACGTCTGTTTTTGACACAGTGACTGCTGGATCTTTAAACATCANGTTCAGCTTTGTCTGTCAACCTGTCTGACATGTCGG
GACCCGTGCCAAGCNNGGCCAGAGTTTACACAGATGTTAACACACACAGACCCCGAGAGTACTGGGATTATGAATCACAT
GTGGTGGAATGGGGGAATCAAGATGACCTATCAGCTTGTTCGAAAATTAGGTAGGGGCAANTACAGTGAAGTGTTTGAAG
CCATCAACATCACAAATAATGAAAAAGTTGTTGTTAAAATTCTCA
Sequence Type mRNA
Unitrap ID UNI1321

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152076173..152080055 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074698 (Csnk2a1) NM_007788 casein kinase 2, alpha 1 polypeptide Gene [Source:MGI (curated);Acc:Csnk2a1-001]

 
Come back to gene ENSMUSG00000074698


For any suggestions or comments, please send an email to unitrap@crg.es