Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0919
Clone ID GC0919
Cell line E14Tg2A.4
Vector pFlip1
Project tigem
Note NULL

Sequence tag GC0919
Sequence
TTTTGCCCCCATTGTTCTTCAGGACATTGGAGAGGTTGACAGAGGCAGTGCCCAGTAGTTCATTCCTCAAGGTATGACAG
CTCCAGACCTTCAGATCCAAATGACTCTGGCCTGCCCCATTCAGAACGATGATTTCATTCCAGAGCAGTTCAGAGCTCCC
GATGCGCTTCCCCGTCTTCTTGGTCTCGCTGGGGAGTCCATCCACTGCCACCTCCACGTAGGAGTTGATTCTGGGCTGGC
GGTTGTGCACCTTGGGCTTTGCTGACACCACTTTCAGGGTAAGCTGGGACTTCTCAAAAGGCAGGGCCACTCCTGCCCGG
CTGGAGCTGGCAGATGCCATGTCATCACAATGGAACTGCCGGGGCCACAC
Sequence Type mRNA
Unitrap ID UNI340

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109976875..109981901 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031930 (Wwp2) NM_025830 WW domain containing E3 ubiquitin protein ligase 2 Gene [Source:MGI Symbol;Acc:MGI:1914144]

 
Come back to gene ENSMUSG00000031930


For any suggestions or comments, please send an email to unitrap@crg.es