Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST403903
Clone ID OST403903
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST403903
Sequence
CTGAGGATGCAGTAACCCAGCCTGTGCTTTGGCCGATACGGGCGAGAAGACAACACCCTCATCATGACTACTAGAGGTGG
CAGGCCTGATCATCAAGATCCTGAAGCGCACAGCAGTGTTTGTGGAAGGGACTGGGTGAGGTGGGCCCACCGCTAGCACA
GACCACAAAACTCAGTGCTGCCACCACCACCCAGCGCATTAACGTATTTTAAAAAAA
Sequence Type mRNA
Unitrap ID UNI16140

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4478755..4895033 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006464 (Bbs1) NM_001033128 Bardet-Biedl syndrome 1 (human) Gene [Source:MGI Symbol;Acc:MGI:1277215]

 
Come back to gene ENSMUSG00000006464


For any suggestions or comments, please send an email to unitrap@crg.es