Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST403829
Clone ID OST403829
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST403829
Sequence
GACTGAGGGAGGCACCTCATGCCCTGGCTACAGGAAGCAGTCACGTGTGGACCCTTTATTAGGCACTGCCATATAAGCTC
AGGGCACAAGAGACCAGGACATCCCTAGGCAAAGATCAGCAAGCAAAGGCCATGCTGACTGCAATGTTGCTGAGTTGTGT
TCTGCTGTTGGCACTGCCTCCCACACTGGGGGTCCAGATGGGCGTGGCCTCCACTGAAGGGCATCAGAAGGCCTGACCAG
GCTCTGTTCCCAGAGTTCCCAGGTCTAAGTCTGAATGGCCTCAAGAAGACAACTGCAGACCGAGCAGAAGAAGTTCTGCT
GCAGAAGGCAGAAGCTTTGGCGGAGGTGCTAGATCCACAGAACCGCGAGTCTCGTTCTCCGCGTCGCTGTGTAAGGCTGC
ACGAGTCCTGCTTGGGACAGCAGGTACCTTGCTGCGACCCGTGCGCTACGTGCTACTGCCGCTTCTTCAATGCCTTTTGC
TACTGCCGCAAGCTGGGTACGGCCACGAACCTTAAAAACC
Sequence Type mRNA
Unitrap ID UNI18710

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108090672..108091628 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005705 (Agrp) NM_007427 agouti related protein Gene [Source:MGI Symbol;Acc:MGI:892013]

 
Come back to gene ENSMUSG00000005705


For any suggestions or comments, please send an email to unitrap@crg.es