Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BA0345
Clone ID BA0345
Vector pGT2lxr
Project sanger

Sequence tag BA0345
Sequence
ATGAACAGGAGAGACGGAAGGTGAAACAGAGCAGAAAAGGATCCGAAAGAAGAAAGCAAAGAAGAGAGACTCAGAGACTA
TAGAAGATGTGGCAGTAGAGCCGCTTCCCCTGCCTGGATCTCCTGTACGAGGCCAGAAGAAGAGTGCTTCCAGCTTTTTC
CAGAAGCTCAGAGAAGAACTGCAGTCTGCTCCTGTTGCCC
Sequence Type mRNA
Unitrap ID UNI3637

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 127384980..127385179 196
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031984 (2810004N23Rik) NM_025615 RIKEN cDNA 2810004N23 gene Gene [Source:MGI Symbol;Acc:MGI:1913773]

 
Come back to gene ENSMUSG00000031984


For any suggestions or comments, please send an email to unitrap@crg.es