Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BA0341
Clone ID BA0341
Vector pGT2lxr
Project sanger

Sequence tag BA0341
Sequence
GCTACCCCGAGGACGAAGGTGCACAGACTTTGCCGTCAGGCTCCTAGCTCTCCTCCCGAAGTCCGCCCCAGCGAACATG
Sequence Type mRNA
Unitrap ID UNI672

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 143741305..143741383 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015932 (Dstn) NM_019771 destrin Gene [Source:MGI (curated);Acc:Dstn-001]

 
Come back to gene ENSMUSG00000015932


For any suggestions or comments, please send an email to unitrap@crg.es