Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BA0201
Clone ID BA0201
Vector pGT2lxr
Project sanger

Sequence tag BA0201
Sequence
GACTGGGGCTTGGGTTCCGGCGACATGGCTAAACGCACCAAGAAGGTCGGCATCGTCGGCAAGTACGGGACCCGCTATGG
TGCCTCCCTCCGGAAAATGGTGAAGAAAATTGAAATCAGCCAGCACGCCAAGTACACTTGCTCCTTCTGTGGCAAGACCA
AGATGAAGAGACGAGCCGTCGGCATCTGGCACTGTGGTTCCTGCATGAAAACCAGTGGCCTGGTGGGGCCCTGGACCCTA
CAAGTA
Sequence Type mRNA
Unitrap ID UNI3641

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 75782320..75782558 223
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074800 (CT025556.12)  

 
Come back to gene ENSMUSG00000074800


For any suggestions or comments, please send an email to unitrap@crg.es