Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST401888
Clone ID OST401888
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST401888
Sequence
TGAGTCCTTTAGGGAAGCCAGGGGCGAGCCTCCTCTTCAACTCTGTGGTGAATGTGGGCTGTGGCCCCGCTGAGGAGAGA
GTCCTTCTAACCGGGCTGCATGCAGTGGCCGACATCTACTGTGAGAACTGCAAGACCACACTCGGGTGGAAATACGAACA
TGCCTTTGAGAGCAGTCAGAAATACAAGGAAGGAAAATTTATTATTGAACTTGCCCACATGATCAAAGACAACGGCTGGT
AAAGTGAAGCGGTCCACTCCTGTTTGAATCCTATTTTATGAAAGCTGAGTGTACAGAAGACCTAGCTTCTTGGTGACAAT
GCTTCTTGAACTTAACCTCACAGGCCAGCCCAGTCTCAACACTTGAAGGTGTCTCTCTAGGCTATCCACTTGGTAAGGTG
CCCATTTGAATCCCTGTCGTGTACAATGCGTTTTTGGAAGTCTGAGTTCTTTTTCTAACATCTTAAGTTCTAGAGAAAGA
ATTGACCAGCTGGTGACTCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI19202

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17081689..17084953 345
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022773 (Ypel1) NM_023249 yippee-like 1 (Drosophila) Gene [Source:MGI (curated);Acc:Ypel1-001]

 
Come back to gene ENSMUSG00000022773


For any suggestions or comments, please send an email to unitrap@crg.es