Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST401414
Clone ID OST401414
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST401414
Sequence
ACTGAGCCGAGCCGCTGCTGCTTTGAACGTACAATAGAATCCCTGATGGACCGAGGAGCCATAGTGAGGAACTTGGAAAG
CCTGGGTGAGCGTGCGCTCCCCTACAGGATCTCGAGTCACAGCCAGCAGCACAGCCGAGGAGGGTATTTCCTGGTGGATT
TTTATGCTCCGACAAGTGCTGTGGAGAACATACNTGGAACACTTGGCGCGAGACATTGACGTGGTTAGACCAAATATTGT
GAAACACCCTCTGACCCAGGAAGTAAAAGAGTGTGACGGCATAGTCCCAGTCCCACTTGAAGAAAAACTGTATTCAACAA
AGAGGAGGAAGAAGTGAGAAGATTCACCAGATTCTGGCCTTATATTTAATCCTAAGGGCACTATGGGTGCTGCTAGGTTG
TTGTCTAGGATACTTTAGCCCATGACCATTTTGCTGCAGGAGGTAGAAACTGCTGGCCGAGACCTGCCCTGATGTCTCTG
CTGAGATTTCATCCCACTTGTGGGGTTTGTCGGG
Sequence Type mRNA
Unitrap ID UNI14644

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 92099837..92112347 368
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039680 (Mrps6) NM_080456 mitochondrial ribosomal protein S6 Gene [Source:MGI (curated);Acc:Mrps6-001]

 
Come back to gene ENSMUSG00000039680


For any suggestions or comments, please send an email to unitrap@crg.es