Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XT0219
Clone ID XT0219
Vector pGT0lxf
Project sanger

Sequence tag XT0219
Sequence
CGGACAACAGCTGGCGCCAGNCTTTCCGCACCAAGAGCTAGCGCTGTTTCTTCTTCCGGGTGTCTGATGAGCTGCGACAG
CAGCAGCGCAGGGAGATGCTGAAGGACCCTTTTGTGCGCTCCAAGTTCATCTCGCCGCCCACCAACTTCAACCACCTGGT
GCACCTGGTGCACGTGGGCCCTACGGAGGGAAGGCCCAACACCAGGGATGGGAATTCATGGGAAGAGGAACCGAAA
Sequence Type mRNA
Unitrap ID UNI3645

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6322057..6322330 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024769 (Cdc42bpg) CDC42 binding protein kinase gamma (DMPK-like) Gene [Source:MGI (curated);Acc:Cdc42bpg-001]

 
Come back to gene ENSMUSG00000024769


For any suggestions or comments, please send an email to unitrap@crg.es