Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XT0209
Clone ID XT0209
Vector pGT0lxf
Project sanger

Sequence tag XT0209
Sequence
GCCCAGAAGTCTAACGTCAAGAAGCACATGCAGACTCATAAGGTGTGGCCTCCAGGGCGAAGTGGCGGCACAGTCTCCCG
AAACTCGGGGACCGTACAAGTCATGGCTTGGAACCCCAACAGGCAGGAAGAAGAAGTCACGGGGGCGGGTCAGGCCCGGT
GCAANACCANATCAGNNNNAGNNCNNNNCNNNNNNTTTGACCACGGGGGATGGAGGTGGACTTTTTTTTTTTTTTTCATT
CTTTATCTATGTCTCGGTCTTGTGTCAGTTCTGCCCCAGCAAGTTCAGCACCTACTTCCAGCTCAAGTCCCACATGATTC
AGCACAAGAAGGAGCAG
Sequence Type mRNA
Unitrap ID UNI3646

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154458064..154460013 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059842 (Zfp341) NM_199304 zinc finger protein 341 Gene [Source:MGI (curated);Acc:Zfp341-001]

 
Come back to gene ENSMUSG00000059842


For any suggestions or comments, please send an email to unitrap@crg.es