Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST399700
Clone ID OST399700
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST399700
Sequence
TGGAACCCCTACGGGTTCTGAGCTGTTGCTGGCTATTCTGCAGAGGACTGTGAAGCACCCTGTGTGTGTGCAGCACGGAC
CTTCTGNGAAGTATGCCCGCTGCTTTCTCTCAAAGCTCATCAAAAAGCATGAGGCTGTACCCACGGNAGCCTTTGGANGC
ACTGTATGANGCGTTGNNAGAGGTTTTGATGACCCANGAGTCCACCCAGATGCCACCGGAGCTATTTGCTGCCTTNAGGA
NACTCANCTACACNTCTNTGAGAGCACNGCCATCGTGTCCCATGGCACCACAGNCTTGGNTACATGGGACGNTGNTCTNT
ACCTGNNAGANNGGNCCATTGNNAACCCACNAGNCCTTCACTGACAGGACTATCCTGNNNCTAGGCNGTGCAGCTNGCCT
TACANGCCNGNCNATNTNGCAAGGCNTGCTGCCTCCANAGCATACATCGTTCAGCCG
Sequence Type mRNA
Unitrap ID UNI19233

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 5248839..5253158 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022544 (5730409G15Rik) NM_027446 RIKEN cDNA 5730409G15 gene Gene [Source:MGI Symbol;Acc:MGI:1917761]

 
Come back to gene ENSMUSG00000022544


For any suggestions or comments, please send an email to unitrap@crg.es