Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST398887
Clone ID OST398887
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST398887
Sequence
TATGTACCACTGGGTGGNNTAGCGGTCGAAGCATGCGCATAATGGGTTTCCGGGGCACTACCATCAANCCGCTGAATGAG
GAGGCAGCAGCAGAGCTGGGTGCTGAGCTGCTGGGCGAGGCCACCATCTTCATTGTGGGTGGAGGCTGCCTGGTCCTGGA
GTACTGGCGCCACCAGACTCAGCAGCGCAAGAAGGAGGAGAATAAATTTATGAATGAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI16565

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 19830103..19833216 176
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052214 (Opa3) NM_207525 optic atrophy 3 (human) Gene [Source:MGI Symbol;Acc:MGI:2686271]

 
Come back to gene ENSMUSG00000052214


For any suggestions or comments, please send an email to unitrap@crg.es