Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0934
Clone ID GC0934
Cell line E14Tg2A.4
Vector pFlip1
Project tigem
Note NULL

Sequence tag GC0934
Sequence
TTTTCATGTCATTTTTTAACACTACAATTCTCTTATGACCATGTCCTTTTATCCAGACCACCTGTGGGATGGCTCCCAGT
AATTCCTCCACACTACTGTAGCCATAAGTTTTGGGCTGAAGTGTTTCTCCAACATATTTGTTATAGGCATGAAAAATG
Sequence Type mRNA
Unitrap ID UNI346

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 14116083..14117472 91
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060657 (4921513D23Rik) NM_001081154 RIKEN cDNA 4921513D23 gene Gene [Source:MGI Symbol;Acc:MGI:2444505]

 
Come back to gene ENSMUSG00000060657


For any suggestions or comments, please send an email to unitrap@crg.es