Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST397750
Clone ID OST397750
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST397750
Sequence
CAGCTCATGGCGGTGGAAGGAGGAATGAAGTGTGNCAAGTTTTTGCTCTACGTTCTCCTGCTGGCCTTCTGCGCCTGTGC
AGTGGGATTGATCGCCATTGGTGNAGCGGTTCAGGTTGTCTTGAAGCAGGCCATTACCCATGAGACTACCTGCTGGCTCG
CTGTTGCCTGTGGTCATCATTGCAGTGGGTGCCTTCCTCTTCCTGGTGGCCTTTGTGGGCTGCTGNGGGGCCTGCAAGGA
GAACTACTGTCTCATGATTACATTNGCCATCTTCCTGTCTCTTATCATGCTTGTGGAGGNGGCTGNGGCCATTGCTGGCT
ATGTGTTTAGAGACCAGGTGAAGNCAGAGTTTAATAAAAGCTTCCAGCAGCAGATGCAGAATTACCTTAAAGACAACAAA
ACAGCCACTATTNTGGACAAATTGCAGAAAGAAAATAACTGCTGGGGAGCTTCCTAACTACACAGACTGGGAAAACATCC
CCGGCATGGCCAAC
Sequence Type mRNA
Unitrap ID UNI11290

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 128347457..128349275 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025351 (Cd63) NM_007653 CD63 antigen Gene [Source:MGI Symbol;Acc:MGI:99529]

 
Come back to gene ENSMUSG00000025351


For any suggestions or comments, please send an email to unitrap@crg.es