Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST397273
Clone ID OST397273
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST397273
Sequence
ACTGAGACCCCTAAGGAGGACCTGGGCTCCAAGTTTGGCATGGACCTGAAGCGAGGGATGCTGCTGAGGCTTGCTCGCCA
GGACCCCCATCTCCACCCTGAGAACCCTGAGCGGAGAGCAGCCATCTATGACAAGTACAGGAGCTTTGTCATCCCCGAGG
CAGAGGCCGAGTGGGTTGGCCTGACGCTGGAGGAGGCCCTGGAGAAACAGAGGCTTCTGGAGGAAAAGGACCCTGTACCC
CTGTTCAAGGTCTACGTAGAGGAGCTGGTCCAGCGGCTTCAGGAGCAGGTTCTGTCCAGGCCCGCAGTGGTGCAGAAGAG
AGCCGGTGACCACGCCTGAGCACTGGGCTCAGCCTCCCCTGTGGGCAGTGGGCGAACCCCACTTGGCATGTGCCGAGCAC
ACAGTTCCTGTGGTAGACTTTTCAGAGAACCCTTCTGTGCCAGGACTCGTGGAAGCCTGGAGCGGAGCAGATGCCTGTCC
AAGCTGGTCAAGTCCTTCTAGTTCTTGGGCTGAAATAAGTAACAGTCTGAGGCAGCCTGCGCCACGGTTGGCCCCG
Sequence Type mRNA
Unitrap ID UNI19278

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26262200..26263535 320
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024181 (Mrpl28) NM_024227 mitochondrial ribosomal protein L28 Gene [Source:MGI (curated);Acc:Mrpl28-001]

 
Come back to gene ENSMUSG00000024181


For any suggestions or comments, please send an email to unitrap@crg.es