Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST396743
Clone ID OST396743
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST396743
Sequence
CAATTTAAAGTGGACTGNATTTTGGTAAGTACAATACCTCACAATCTGACATTCTTAAATAAATATTGATTCTAAATATG
AAAAAAA
Sequence Type mRNA
Unitrap ID UNI9013

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72424856..72424934 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037674 (Rfx7) NM_001033536 regulatory factor X, 7 Gene [Source:MGI Symbol;Acc:MGI:2442675]

 
Come back to gene ENSMUSG00000037674


For any suggestions or comments, please send an email to unitrap@crg.es