Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CD0047
Clone ID CD0047
Vector pGT0lxfT2
Project sanger

Sequence tag CD0047
Sequence
AGATGTTTTTATGAAGGGATGGCCAGCTGTGGCTGTGTGCTCCACAGGCAAAACANATATGGAAGTGCTTAGCAGAGAAT
GCGGTTTATCTTTGTGATCGTGAAGCCTGTTTTAAGTGGTATTCCAAATTAATGGGAGACGAACCTGACTTAGATCCTGA
TATCAATAAGGACTTCTTTGAAAGTAATGTGCTTCAGCTTGATCCTTCCCTGTTAACTGAAAATGGGATGAAGTGTTTTG
AGAGATTCTTCAAAGCTGTGAATTGTCGAGAAGGAAAACTAGTAGCAAAAAGAAGAGCCTACATGATGGATGATTTGGAA
TTGATAGGATTAGACTATCTTTGGAGA
Sequence Type mRNA
Unitrap ID UNI3658

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12700294..12700636 335
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031010 (Usp9x) NM_009481 ubiquitin specific peptidase 9, X chromosome Gene [Source:MGI (curated);Acc:Usp9x-001]

 
Come back to gene ENSMUSG00000031010


For any suggestions or comments, please send an email to unitrap@crg.es