Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CD0043
Clone ID CD0043
Vector pGT0lxfT2
Project sanger

Sequence tag CD0043
Sequence
GGTTGTGAGTTTTTGTAGATGGTGGTTGTGAGCTTGAGCTGATGGTGATGGTGGTTGTGAGCTCTTCTAGATGGTTTTTT
AAAAATGATAAAAGCAAAACTTGGCAAGCAAACCTTCGATTGATCTCTAAGTTTGATACTGTTGAAGACTTTTGGGCTCT
ATACAACCATATCCAGTTGTCTAGTAATTTAATGCCTGGCTGTGACTACTCACTTTTTAAG
Sequence Type mRNA
Unitrap ID UNI1720

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 138210633..138213290 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028156 (Eif4e) NM_007917 eukaryotic translation initiation factor 4E Gene [Source:MGI Symbol;Acc:MGI:95305]

 
Come back to gene ENSMUSG00000028156


For any suggestions or comments, please send an email to unitrap@crg.es