Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST396378
Clone ID OST396378
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST396378
Sequence
ACTGAGATGCACAAAGCAGGGTCATCAGAAGCCCCTCGATTCAAAAGACGAGAATCCTGAGAAACATTGCCCACTGACGG
TGAACCCCTGGCACATGAAGAAAGCCTTTAAAGTCATGAACGAACTCAGAAGGTAACGTCACTCTAATGCACACGCACCC
ATTAGTCTTCCTTTTATTTCTCTTTGTCCATAGGGGCCCCTCCCCTCCCCCATTGTTGCTCGAACACAGGGAACATCAAA
AGCTTTTCTGCGAGGTTTTTAGGAGAAGCGAGGCCATCAGAAGCGAAGCGCAGGTGCTAGAGAGCTCCTCCGTCCAGCAG
CGGCTGGTCAAGCCCGGCGAGTGAGTTCAGGCTTTCTCTAAGAAAAGTCTACTGTGGCTTTCCAGGGACGTCGTTCATTT
CTCTTTCTTTCCTTTGAGAGAAGGTCCTGTGTATTCCTGGGTGAGGATGACCTTGAACTCCTGACCCTCCCTTTGCTGTC
CAAGTACTGGATGACAGGCGTGTTCTACCG
Sequence Type mRNA
Unitrap ID UNI18522

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 67357965..67358469 505
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031605 (Klhl2) NP_848748 kelch-like 2, Mayven (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1924363]

 
Come back to gene ENSMUSG00000031605


For any suggestions or comments, please send an email to unitrap@crg.es