Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST395601
Clone ID OST395601
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST395601
Sequence
CCCTCTGTGCCAGGCTGAGGAGTCTCGGTCACACGAGTCCCTGCTCAGCCCCAGCAGCGCAGTGGAGGCCCTGGACCTCA
GCATGGAGGAGGAGGTGATTATCAAGCCCTGTTCACAGCAGCATCCTGGGTCAGGACTACATGCTTCGAGGTGACATCAT
C
Sequence Type mRNA
Unitrap ID UNI19310

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 35563171..35563324 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026883 (Dab2ip) NM_001001602 disabled homolog 2 (Drosophila) interacting protein Gene [Source:MGI (curated);Acc:Dab2ip-002]

 
Come back to gene ENSMUSG00000026883


For any suggestions or comments, please send an email to unitrap@crg.es