Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST395208
Clone ID OST395208
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST395208
Sequence
TGAGGACTGCCCCAACTCCAGTACAGCTGCTCTATCCAGTGTCCAGATTCAGCAATGTCAAGTCCCTCCAGCATCTTTGC
AGATTCCGGATCCGGCAGCTTGTCCGAATAGACCATATTCCGGATCTGCCACTGCCTAAACCTCTGATCTCTTACATTCG
AAAGTTCTACTACTATGATCCTCAGGAAGAGGTGTACCTGTCCCTAAAGGAAGCGCAGCTCATTTCCAAACAGAAACAAG
AGGTGGAGCCTTCCACGTAGCAGCAAGGACCCCTGCTGTTGAACATGAAGGCATTTGATCGCCAGGCTCCAGCTTGAAGA
ACCAAATGAGGCTACCACAAAAGAAGAATCTGGCAGAAAGAGAAGAGCGGGTTGTGATTCCTGGCACAGACTTTGGTTCC
CCTGTAGCCCTGGGGCTTGGAAGAAGCACACAACCATCCTCCAAGTGGGGCTCCCCACTCCCCAACCCATGAACCCCAGG
GCCAGATGAGCTCCTTGGAAAACTGGAAGAAGTCTTAACACTGTTTGTTTTCAGAA
Sequence Type mRNA
Unitrap ID UNI19326

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97250424..97254948 248
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038485 (Socs7) NM_138657 suppressor of cytokine signaling 4 Gene [Source:MGI (curated);Acc:Socs7-001]

 
Come back to gene ENSMUSG00000038485


For any suggestions or comments, please send an email to unitrap@crg.es