Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0943
Clone ID GC0943
Cell line E14Tg2A.4
Vector pFlip1
Project tigem
Note NULL

Sequence tag GC0943
Sequence
AATCATAGTGGGCAGCATCCCAGGGTCGGAGGGCTGAGCCCGGAATACGAGCAGGGGTTGGCCCCTGCGTAGTGGCACCT
CTGGTCTGAAGACAGCTCCGTTGAGCATCTGCAGCATTGGTGTGGTGCCCTGGACCAAGCCCACGGCTTGGTAGGGAGCA
CCTGCCAGGGCCACAGTCAGGAGGCATT
Sequence Type mRNA
Unitrap ID UNI349

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 98118092..98118279 188
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053398 (Phgdh) NM_016966 3-phosphoglycerate dehydrogenase Gene [Source:MGI (curated);Acc:Phgdh-001]

 
Come back to gene ENSMUSG00000053398


For any suggestions or comments, please send an email to unitrap@crg.es