Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST394915
Clone ID OST394915
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST394915
Sequence
ACTGAGGATTCCAGGCCTCTACATGTCGTGCTGGGCAAATGAAGCCTGCGACTTAGTACTCCATGGTGTCTGCTCTCGCC
TTGGCCTTNTACCTAACANAGACGTCTGAAGCTGAAGACATCTTTATACCAGTTTTAAATATAAAGCGTTCTGAGCTTCC
T
Sequence Type mRNA
Unitrap ID UNI17566

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95069483..95072247 85
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015711 (Prune) NM_173347 prune homolog (Drosophila) Gene [Source:MGI (curated);Acc:Prune-001]

 
Come back to gene ENSMUSG00000015711


For any suggestions or comments, please send an email to unitrap@crg.es