Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST394890
Clone ID OST394890
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST394890
Sequence
GCTGCACACACACTTCTNAANAAGAGGCTTTGCTGGGCGTGGAGANATGGCGTTANCGNCATGCNAGCACNANACGTACC
CTTCCANNGNCNCTGANNNCAGNTCCNNGNANCCCACATGGGTGGCGTCACNANACATCCGTAGCTGAAATCTGANGCCC
TCTTCTGGAGTGGNTGAAGATAGCGTACACGCGNACTGTACATATAATANTATAGATCGCTATGANNACTNNNTNTTATC
CAGACACCCGATGNTATATTGATGTGTTTTTCCATTGACAGCCCTGATAGTTTAGAAAACATCCCAGAAAAATGGACTCC
AGAAGTCAAGCATTTCTGTCCAAATGTGCCCATCATCCTGGTTGGGAACAAGAAGGACCTTCGGAATGACGAGCACACGA
GACGGGAGTTGGCCAAAATGAAGCAGGAGCCGGNAAAACCTGAAGAAGGCAGANATATGGCAAACAGGATTGGCGCTTTT
GGG
Sequence Type mRNA
Unitrap ID UNI16761

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108233264..108239035 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007815 (Rhoa) NM_016802 ras homolog gene family, member A Gene [Source:MGI Symbol;Acc:MGI:1096342]

 
Come back to gene ENSMUSG00000007815


For any suggestions or comments, please send an email to unitrap@crg.es