Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST394766
Clone ID OST394766
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST394766
Sequence
GACTGAGTTTCCTGCCTGTGATGGATCCCATAATAAGCATAATGAATTGACAGGCGATAACGTGGGTCCTCTCATCCTGA
AGAAGAAAGAAGTATAGCAGTGGCCATTTGAGATGAAACTCTGACAGAGTGTTTCCATGTGTGTTGTGCATAGAAAAGTC
TTTGGAAGTTTTAACTCTCAGTACNTGGTTGAATAATTATTTCTGCCAGTTATTTTCTTGCTACACTACTGCTTATATTT
GGTACTTTATATAGTCAGTCATTTCTATAGAAATCAGATGGTCAAGTCTCATTCTGAAATTAAGTTTAATGTGTCTTTCA
ACAATAAAGTCAGCACTTCAGATTTTAATTAATTGGGAATTTAAAGTTTGACTGTGGGCCAAAAGTTATTTCTTTGTATA
TCAGTATTTCAACAGAATACATAGTTTTAAAAAAATTAAA
Sequence Type mRNA
Unitrap ID UNI2547

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135071425..135071856 429
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028165 (Cisd2) NM_025902 CDGSH iron sulfur domain 2 Gene [Source:MGI (curated);Acc:Cisd2-001]

 
Come back to gene ENSMUSG00000028165


For any suggestions or comments, please send an email to unitrap@crg.es