Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST394584
Clone ID OST394584
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST394584
Sequence
AAGACTGATGAACATGCAGCACTGCAACCTTCTCTGCCTGCCGGAGAACTACCAGATGAAGTACTATTTCTATCATGGCC
TCTCTTGGCCCCAGCTTTCTTACATTGCTGAGGATGAGAATGGGAAGATTGTGGGCTACGTCTTGGCTAAAATGGAAGAG
GACCCAGACGATGTGCCCCATGGACATATCACCTCACTGGCTGTGAAGCGTTCCCACCGGCGCCTTGGCCTGGCTCAGAA
GCTGATGGACCAGGCCTCTCGAGCCATGATAGAGAACTTCAATGCCAAATACGTCTCCCTGCATGTCAGGAAGAGTAACA
GGGCCGCCCTGCATCTCTATTCCAACACCCTCAACTTTCAGATCAGCGAAGTGGAGCCCAAATACTATGCAGATGGGGAA
GATGCGTATGCAATGAAGCGGGACCTCACGCAGATGGCTGATGAGCCA
Sequence Type mRNA
Unitrap ID UNI17897

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 71163182..71166705 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031388 (Ard1) NM_019870 ARD1 homolog A, N-acetyltransferase (S. cerevisiae) Gene [Source:MGI (curated);Acc:Ard1-004]

 
Come back to gene ENSMUSG00000031388


For any suggestions or comments, please send an email to unitrap@crg.es