Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AQ0464
Clone ID AQ0464
Vector pGT0lxr
Project sanger

Sequence tag AQ0464
Sequence
GCAGAGCAAAGCCATGACCATGCTGACCATTGAACAACTGTCGTACTTGTTCAAGTTTGCCATTCAGAAAATGAAGCAGC
CAGGGACGGATGCATTCCAGAAGCCTGTTCCATTGGAGCAACACCCTGACTATGCAGAATATATTTTCCACCCCATGGAC
CTTTGTACATTGGAAAAGAATGCAAAAAAGAAGATGTACGGCTGCACAGAAGCCTTCCTGGCCGATGCCAAGTGGATCCT
GCACAACTGCATTATTTATAATGGGGGAAATCACAAGTTGACGCAAATAGCAAAAGTCGTCATCAAAATCTGTGAGCACG
AGATGAATGAAATCGAAGTCTGTCCAGAATGTTATCTTGCAGCTTGCCAAAAACGAGACAACTGGTTCTGTGAGCCCTGT
Sequence Type mRNA
Unitrap ID UNI3669

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165660390..165668348 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es