Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST393921
Clone ID OST393921
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST393921
Sequence
ATGGAGAAGAAGATTGGTTCCAGGTCTTTTAGGGATGGTGNGGTTAAGAAACCTTGTTCTCCAAAGGCCCTGCCCCTCAA
AAAGTCTTCTGCCTTCTCTGGGATCCAGAGGGAGCCATCTAGAAGCTGCCACTCTATATACTATCATGCCTCACAAAACT
GGACTCGATACCGATTACAAGAACTTCGAATCAGGTGTGTGGCCAGAAAGTTCCTGTATTTGTGGATTCGAGTGACTTTT
GGAAGAGTGATTCCCTCTAGAGCCAGG
Sequence Type mRNA
Unitrap ID UNI19346

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3086067..3088966 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023764 (Sfi1) NM_030207 Sfi1 homolog, spindle assembly associated (yeast) Gene [Source:MGI (curated);Acc:Sfi1-001]

 
Come back to gene ENSMUSG00000023764


For any suggestions or comments, please send an email to unitrap@crg.es