Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST393685
Clone ID OST393685
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST393685
Sequence
GCCTCCTGTCTGCCCAATCCGCTGCCAATGTGAGGAAGGAGAGCCTGTGCCAGCCAGCCCTGGAGGTTCTGGAGACATCC
AGCCAGGAGTCCTCACTGGAGAGCGAGACAGACGAGGATGATGACTTCATGGACGTATGAAGGAGTCCACCCAGAGGCCT
GCAGCCATAGCAGGGCAACAGCAAGGCCTGGGATCCCTTTGTCCAGACCCTGGGCAAGGCCAGAAGCCTATGTGAGGTAG
CGTGTCCTGTGGTCTCCTAAGCTGCCCAGCCCCCTCTTTACAGCACCCTGCCTGGGTCCAGGCTGTCCACACATTGTGTT
GGTCCAGAGGAAGATAAGGCCTGTCTTAGGCACGTACGTGCACTGGCTGTGTTTTGCGCAGTAGGGATGGCACTTCTTTT
TGTAATGAAATACTGACTTTTCTTTCCAAGCCCATGTCCGGCTGATCAGGCCCACAGCCCGAGTGCCCAGGGGAGGNCCA
NCNTTGGGTTCTGGTAGAGAACATTTATCAGGAGCCCAGCTCACCCCACACCCTTT
Sequence Type mRNA
Unitrap ID UNI19350

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75108900..75109425 503
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020196 (Cabin1) NM_172549 calcineurin binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1298375]

 
Come back to gene ENSMUSG00000020196


For any suggestions or comments, please send an email to unitrap@crg.es