Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST393408
Clone ID OST393408
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST393408
Sequence
GGTCAACGGGTGCCCTGCACNNGGCTGTGGGGCCTCAGGCACAGCAGTGCTTATCTCGTGGAGGAGATTCAGCTGAGCCC
TGACTCTGAGCCTGTTCGAAACCTGCAGCTGGCCCCCGCCCAGGGTGCAGTGTTTGCAGGCTTCTCTGGAGGCATCTGGA
GAGTTCCCAGGGCCAATTGCAGNGNCTACGAGAGCTGTGTGGACTGTGTGCTTGCCAGGGACCCTCACTGTGCCTGGGAC
CCTGAATCAAGACTCTGCAGCCTTCTGTCTGGCTCTACCAAGCCTTGGAAGCAGGACATGGAACGCGGTAACCCGGAGTG
GGTATGCACCCGTGGCCCCATGGCCAGGAGCCCCCGGNGTCAGAGCCCCCCTCAACTAATTAAAGAAGTCCTGACNGTCC
CCAACTTNATCCCTGGAGCTGCCCTGCCCCCTACCTGTCANCACTTGGNCTNTTACCANTGNNGNNATGGNCNGNGCCAA
NATCTCAGANGCCTCTGTTACCGTCTACAATTGG
Sequence Type mRNA
Unitrap ID UNI19362

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88241047..88242481 161
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028064 (Sema4a) NM_013658 sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A Gene [Source:MGI (curated);Acc:Sema4a-001]

 
Come back to gene ENSMUSG00000028064


For any suggestions or comments, please send an email to unitrap@crg.es