Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST393373
Clone ID OST393373
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST393373
Sequence
ATTGGGACAGGTAATTGTCATCTTTTTCTTGGAGGCAGAGTACGAATAAAGTAATTCAAAGTATGGTCTAAAAA
Sequence Type mRNA
Unitrap ID UNI19365

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 44316529..44316598 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035683 (Melk) NM_010790 maternal embryonic leucine zipper kinase Gene [Source:MGI (curated);Acc:Melk-001]

 
Come back to gene ENSMUSG00000035683


For any suggestions or comments, please send an email to unitrap@crg.es