Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0243
Clone ID GC0243
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0243
Sequence
CTGCCGGTGCTGCCGCCATCACAGTCAGAGCTGCCATTGACTTGGTGCCTATATAGTGACTCTTTACAAGGAAGTGGGCT
AATTCCAAGACTGTGTCAAATGGCTGGCTTAACACTTTCTGGGCCCACTCACACACAAGACGGCAAGCAGAAGAGATAAC
TTCCTCATCAATATTTTGAAGCTGCCCAGATGGTTCAACTCCTTCCAACCCATCTC
Sequence Type mRNA
Unitrap ID UNI6

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72459427..72459635 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037674 (Rfx7) NM_001033536 regulatory factor X, 7 Gene [Source:MGI Symbol;Acc:MGI:2442675]

 
Come back to gene ENSMUSG00000037674


For any suggestions or comments, please send an email to unitrap@crg.es