Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0949
Clone ID GC0949
Cell line E14Tg2A.4
Vector pFlip1
Project tigem
Note NULL

Sequence tag GC0949
Sequence
TACGAAGAATGGGAGCCAGCGGATTAAAGGCTTGCTATATGGCAGGGGATGGATACATGGGCGCGTGGAGCGCCGACCGA
CGCGCGTGAGGCGCTGTGGGAGTGACCCCGTCTCCTCAATGAGAAGATTCCGGAGCTTCGAACAACCAAAGGGACAGTGG
GGACTGCCTCTTAAACAAGCTCCTTCGTTTCGAACTCAGTCTACACGTCTCCATCCCCGCGCTAGCACTCAGTACGCGAA
TGCCCCCGCAGCAGCCATCTTGCGCAAAAGCGATGCGAGCCTTTTGACTCTCGCGCCAACCCGTAGAGCCAGAGCCCTGC
CGAAGAGTTCTGCCAA
Sequence Type mRNA
Unitrap ID UNI351

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180426684..180444765 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]

 
Come back to gene ENSMUSG00000038914


For any suggestions or comments, please send an email to unitrap@crg.es