Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST393142
Clone ID OST393142
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST393142
Sequence
ACTGAGACAGAATCAAGGAGGGACACAGNGTGTACGCACACATTGCCAAACTGCAGGAGTTATGGAAAACTACTCAAATC
CAAACAATTCATATCCCTAAATCAATGACAGATGCATCTTTTCTAAAGCATCCAGAGCTCACCTTGGGCCAGAAGCGTTA
CCTGTGCAGCGTTGCTAAGATCTGTAACTCCAGCTACCTGAGGACCTTGATGAAGAGGCAGTACATGCACATATTTCATC
ACGGGTCACAGAAGACAGGTGTGCTCACTCACCACAGAGGCCATATGAGCTCTCGCTACTCACAGAAACAGCATTCCCCC
TGTACTGCATGGAGACACCATCTGGAGAGAGAGGACTCTCTGAGCATTGCAGCTGGAGCACCTGAAATGATCATACATTC
CCTTTGGCGACCCCTGAGACACAAAGAAGGGTTAAAAATTGGGTATGCATCTAAAACAAGATGCAAGTCCCTGAAGATTT
TTAGAAGACCAGGCAGACTGTTCTTGTTACCT
Sequence Type mRNA
Unitrap ID UNI19371

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122816325..122819649 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029463 (1500011H22Rik) NM_026883 RIKEN cDNA 1500011H22 gene Gene [Source:MGI Symbol;Acc:MGI:1916198]

 
Come back to gene ENSMUSG00000029463


For any suggestions or comments, please send an email to unitrap@crg.es