Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0952
Clone ID GC0952
Cell line E14Tg2A.4
Vector pFlip1
Project tigem
Note NULL

Sequence tag GC0952
Sequence
AAGGGGCAGACCACCACTTTTCAAGAAGTGAAACTGAAAATCCGAGGAATCATCAGTCAAGGGTGCACCAGCGGGCATTA
ACAAGGCATAGACTACCTCTGTTAGGTATAGCACTTGTGAGGCTGAAGGACCAAAGAAAAGTGAGTCAAGAGATGGACTA
AGGCTGCTTTCTCCAAGTTTGGCATGGTCCAAACAAATAGCTCTTAACTTTTCTATTGTCGTA
Sequence Type mRNA
Unitrap ID UNI352

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12708857..12709291 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031010 (Usp9x) NM_009481 ubiquitin specific peptidase 9, X chromosome Gene [Source:MGI (curated);Acc:Usp9x-001]

 
Come back to gene ENSMUSG00000031010


For any suggestions or comments, please send an email to unitrap@crg.es