Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST392706
Clone ID OST392706
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST392706
Sequence
CTGAGAGAGGATCCCTCCCCACCCCCACCTCCCCTACGGCACAAACAGAAATCGAGGNGTGTGACGCATTCCCAGACCAT
CCTGCNAACTCAACACCAGCGACTTCTCTGTGACTGGGTCCAGATAAAGGTCCTTTCAAGACTGACTTCAGTGGATCTAC
TCCACCAGGTCTTCCCGACCTTACTACATCACTGCCAAGTGCTATTGGCGAGACTGCCTGCACCAGCAGAAGACTCACCG
GATCCATCAGAGCGTCGGTTTTACCAGAGCAAAGCAAGAGCCTGTGTGGTTCTGCCTCCCGCTAATACTGGACAGGAAAC
AGCAACTGGCTTGGACTAGAGGCCTGGCTTTCCTTTGAAGGAGCTATTCTGNGATCTGTGTTGCTAGTAAGTGACTGACA
GTATTCTAGACTGGACTGGTCCCTGAGTACAGAGACTGAGNTGCAATTAAGTGAAGAATAAACTTCAAGATCTTGANGAA
CTGCACTAAGGTGCAAGCCAGGTTCA
Sequence Type mRNA
Unitrap ID UNI19380

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 157888210..157898873 442
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050565 (Tor1aip2) NM_172843 torsin A interacting protein 2 Gene [Source:MGI (curated);Acc:Tor1aip2-002]

 
Come back to gene ENSMUSG00000050565


For any suggestions or comments, please send an email to unitrap@crg.es