Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST392375
Clone ID OST392375
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST392375
Sequence
TGAGGCTCTCTCCTAAACCGCTTGGACATGGAGGTGAGTGTCCTGGAGAAGCATCGGGAATCAGGAGATGCTGCTGAGTG
TATCGAGGATCCTCAGGTCAGACCCAGCCTGGAAACCCACAGGAAGACATTAGTGCAACCATCGGATCTGATTGTTGACA
GGATTCATAAATCAACCAATCGTTCATCTGAACATATCTCTCCAAATAAATGGAGGAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI19391

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 150365789..150366013 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029658 (4930434E21Rik) NM_029440 RIKEN cDNA 4930434E21 gene Gene [Source:MGI Symbol;Acc:MGI:1923042]

 
Come back to gene ENSMUSG00000029658


For any suggestions or comments, please send an email to unitrap@crg.es