Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XT0193
Clone ID XT0193
Vector pGT0lxf
Project sanger

Sequence tag XT0193
Sequence
GGGCAGAGCAGGTGAAGGACTTAACTCAGTACCTGGACCCGAGTGGGCTTGGCGTAATCAGCTTTGAAGATTTCTACCAA
GGGATTGTAGCCATCAGAAATGGAGATCCTGATGGCCAGTTGTACAGCGTGGAGCCTGTCCAAGATGAAGAGACCCCTGC
CTGTGCCGATGAGTTTGACGACTTTGTCACCTATGAG
Sequence Type mRNA
Unitrap ID UNI3676

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26161320..26173631 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037098 (Rab11fip3) RAB11 family interacting protein 3 (class II) Gene [Source:MGI (curated);Acc:Rab11fip3-001]

 
Come back to gene ENSMUSG00000037098


For any suggestions or comments, please send an email to unitrap@crg.es