Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST392009
Clone ID OST392009
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST392009
Sequence
TTGTTCGGGACACGCCCGGCGGATTTTCTGGGCAGAANCCGGTGTGGCTGNGGGAGACTGGGTACTGAATATTNACGGGG
AGAACGCGGCCAGCCTCACGCACATCGAAGCCCAGAACAAGATCCGCGCCTGTGGGGAGCGCCTCAGCCTGGGTCTTAGC
AGAGCCCAGCCTGTTCAGAGCAAACCACAGAAGGCCCTGACCCCTCCCGCCGACCCCCCGAGGTACACTTTTTTNCCAAG
CGCCTCCCTCAACAAGACGGCCCGGCCCTTCGGGGCACCCCCACCTACTGACAGCACCCTGCGGCAGAATGGACAGTTGC
TCAGACAGCCGGTCCCCGANGCCAGCAAGCAGCGGCTGATGGAGGATACCGAAGACTGGCGGCCGCGGCCGNNGACAGGC
CAGNCCCGTTCCTTNCGCATNCTTGCCCACCTNACGGGCACAGAGTNCATGCAAGACCCGGATGAGGAAT
Sequence Type mRNA
Unitrap ID UNI18637

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 55608831..55610402 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021493 (Pdlim7) NM_026131 PDZ and LIM domain 7 Gene [Source:MGI Symbol;Acc:MGI:1914649]

 
Come back to gene ENSMUSG00000021493


For any suggestions or comments, please send an email to unitrap@crg.es