Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST391983
Clone ID OST391983
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST391983
Sequence
TCGCAATGACAGGTTNAACACCTTGCTCATCCATGAGTAATCATACGAAGGAGAGGGTGATNATGACCAAAGTGACACTG
GAGAATTTTTATAGCAACCTTATCGCTCAACATGAAGAACGAGAAATGAGACAAAAGAAGTTAGAAAAGGTGATGGAAGA
AGAAGGCCTGAAAGACGAAGAGAAACGACTCAGAAGATCCGCGCACGCTCGGAAGGAAACAGAGTTTCTTCGATTAAAGA
GAACAAGGCTTGGACTGGAAGATTTTGAGTCTTTAAAAGTCATAGGCCGAGGAGCATTTGGTGAGGTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI19402

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29128230..29137081 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024006 (Stk38) NM_134115 serine/threonine kinase 38 Gene [Source:MGI (curated);Acc:Stk38-001]

 
Come back to gene ENSMUSG00000024006


For any suggestions or comments, please send an email to unitrap@crg.es