Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST391765
Clone ID OST391765
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST391765
Sequence
ACTGAGGCTCCTGTTCCAGATCATCCCACGGGGNAGCAGGTCCCAGGTGCTCGCCCCATAGGCTTCCATCTAAGCCCCAG
TTTTGGTATGTCTTTGGTGGTGGGACCCAGCTCACAATCCTAGGTCAGCCCAAGTCTGACCCCTTGGTCACTCTGTTCCT
GCCTTCCTTAAAGAATCTTCAGGCCAACAAGGCCACACTAGTGTGTTTGGTGAGCGAATTCTACCCAGGTACTTTGGTGG
TGGACTGGAAGGTAGATGGGGTCCCTGTCACTCAGGGTGTAGAGACAACCCAACCCTCCAAACAGACCAACAACAAATAC
ATGGTCAGCAGCTACCTGACACTGATATCTGACCAGTGGATGCCTCACAGTAGATACAGCTGCCGGGTCACTCATGAAGG
AAACACTGTGGAGAAGAGTGTGTCACCTGCTGAGTGTTCTTAGACCACAATCCTCCCTGAAGCCTCAGGGGCCTGGATCT
GAAGTGCCAGAAAAAGTTG
Sequence Type mRNA
Unitrap ID UNI13377

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 16860852..16862639 378
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075370 (Igll1) immunoglobulin lambda-like polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:96529]

 
Come back to gene ENSMUSG00000075370


For any suggestions or comments, please send an email to unitrap@crg.es