Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XR0991
Clone ID XR0991
Vector pGT0lxf
Project sanger

Sequence tag XR0991
Sequence
TTTTTTAAAAGGTTTTTTTTTTTTTTTTTAGGATCTTCCACTTGTGGAGGTGTAAAAAATACAGGGATCAATTCACAGAC
CAGCAGAAACTTATTTATGAAGAGAAGCTCGAGGCCAGCGAACTCTTCAAAGACAAGAAGGCTTTATATCCTTCTAG
Sequence Type mRNA
Unitrap ID UNI3680

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 51817139..51817246 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018417 (Myo1b) NM_010863 myosin IB Gene [Source:MGI (curated);Acc:Myo1b-002]

 
Come back to gene ENSMUSG00000018417


For any suggestions or comments, please send an email to unitrap@crg.es