Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST391582
Clone ID OST391582
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST391582
Sequence
GACTGAGGACACTTTTGTGGATCTCTACGGGACAATGCAGCAGCCGAGAGCCGGAAAGGCCAGGAGCGCTTCAACCGCTG
GTTCCTGACGGGCATGACTGTGGCTGGTGTGGTTCTGCTGGGCTCACTCTTCAGTCGGAAGTGACCAGACACTGACCGTC
CACTCACCTCTCACCTCCCACCCTGCCCCCACCACAACTCTCTCTTCAGCCACCATTGCTACCAGGAGAACCACTACATG
CAACTCACGCCCCTTGCCCTATCACAGGGTTGGGCCTAGACGGAGTCCCCTGCAATTAGCTTTCTAGGATCTACCACACT
TCTGTGAAAGCCACCTTCCCCCCACATCTCAGTTCTCTTGGCCTCAAAACTCACAAGGTTTTCCCCTAAACCAGCTCCTT
GGAGGCTGGCAGGAGCAGAGAGGGGTGTGTGAGGGAGGAGAGCCTGTCTTGTTGGTGGGACCCTAATTACCCCTGAGCCT
CTCGGGAATGCTTTTCCAGCAGGGAGCTCTTC
Sequence Type mRNA
Unitrap ID UNI16383

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152607513..152608020 504
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007659 (Bcl2l1) NM_009743 BCL2-like 1 Gene [Source:MGI (curated);Acc:Bcl2l1-001]

 
Come back to gene ENSMUSG00000007659


For any suggestions or comments, please send an email to unitrap@crg.es