Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST391497
Clone ID OST391497
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST391497
Sequence
CTTTGCCACCACCTGNNCCTACTTGNNNAAGACTACTTTGGGATNCGNNNNGTGGACCCAGATAACGCNAGCTGNCATTG
GTTGGNGTNTACANCAGNCAGNGGNGAAGCAAGCATGAGATCCCAGCCTCCGTTCACCATGTGCTTCCGCAGTGAAGTTT
TACCCTGCTGACCCCGCTGCCCTGAAAGAGGAAATAACCAGGTACTTAGTCTTCCTTCAGATCAAAAGGGATCTCTACCA
CGGCCGTCTTCTCTGTAAAACATCGGATGCCGCCTTGTTAGCGGCCTATATCCTTCAAGCGGAGATTGGGGATTATGACC
CGGGAAAGCACCCTGAAGGCTACAGCTCCAAGTTCCAATTTTTCCCGAAACATTCAGAGAAACTGGAAAAGAAAATTGCT
GAGATTCACAAGACCGAACTCAGGACTTTGGNCCTACTACAACAATNAACAATAATCCAAAAAATG
Sequence Type mRNA
Unitrap ID UNI19417

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 121398605..121417465 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027238 (Frmd5) NM_172673 FERM domain containing 5 Gene [Source:MGI (curated);Acc:Frmd5-001]

 
Come back to gene ENSMUSG00000027238


For any suggestions or comments, please send an email to unitrap@crg.es