Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST391268
Clone ID OST391268
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST391268
Sequence
GGCCTGATCCAAGGAACCAGAGCAGCTGAGGAAGCTATTTATTGGTGGTCTGAGCTTTGAAACCACAGATGATAGCTTAA
GAGAACATTTTGAGAAATGGGGCACACTTACAGACTGTGTGGTAATGAGAGATCCCCAAACAAAACGTTCCAAAGG
Sequence Type mRNA
Unitrap ID UNI19433

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 97711660..97711817 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059132 (CT009632.14)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 122517166..122517323 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066538 (AC164315.2)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114538745..114538902 148
 
EST/CDNA Est Name
  CA553980.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 16236729..16236886 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059179 (AC158589.7)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 111480868..111481025 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060887 (AL671895.9)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 54285394..54285551 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069014 (AC121785.3)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 77702084..77702241 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067669 (AL844863.7)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 9564663..9564820 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067880 (AC103620.12)  

 
Come back to gene ENSMUSG00000067880


For any suggestions or comments, please send an email to unitrap@crg.es