Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST391194
Clone ID OST391194
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST391194
Sequence
TGCTGCCGTTTAATAAATCCTCCCTGTTAGCTGTGAANNANCTGNNATATTCTCAATAGCCTCCTGTTCCTTTCAAGTGA
GCTCACAAATTCTCTATGAGCTGCAGAAAGGCCAAGCGCTCATCACCTTTGANAAGGAAGAAGTCGCACAAAATGTGATA
TCGATGGGGAATCATGTCGTGCAGATGGAAGGCACCCCAGTGAAGGTCTCTGCACACCCAGTCCCACTAAACACAGGCGT
CAGATTCCAGGTTCATGTGGACATTTCTAAAATGAAGATCAATGTTACGGGAATTCCCGATGAGCTGTCTGAGGAGCAAA
CAAGGGACAAACT
Sequence Type mRNA
Unitrap ID UNI19435

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 51808066..51841811 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026946 (Nmi) NM_019401 N-myc (and STAT) interactor Gene [Source:MGI (curated);Acc:Nmi-001]

 
Come back to gene ENSMUSG00000026946


For any suggestions or comments, please send an email to unitrap@crg.es