Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AJ0211
Clone ID AJ0211
Vector pGT0lxr
Project sanger

Sequence tag AJ0211
Sequence
TTTTTTTTTCCACCCCAATGATCATGTTAACAAAAGCCAGAGCTCGAATGACACTTTTCCCACAGCAATGCATATTGCTG
CTGCAGTGGAAGTTCACAAGGTCCTGTTGCCAGGGTTACAGAAGCTCCATGATGCTCTCAGTGCAAAATCCAAAGAGTTT
G
Sequence Type mRNA
Unitrap ID UNI423

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 177542340..177544897 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026526 (Fh1) NM_010209 fumarate hydratase 1 Gene [Source:MGI Symbol;Acc:MGI:95530]

 
Come back to gene ENSMUSG00000026526


For any suggestions or comments, please send an email to unitrap@crg.es